Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGA771-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
720bp
Gene Synonym
BCL2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human B-cell CLL/lymphoma 2, nuclear gene encoding mitochondrial protein, transcript variant alpha Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
KpnI + XbaI (6kb + 0.77kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BCL2 (B-cell leukemia/lymphoma 2, N-Histidine-tagged), also known as Bcl-2, belongs to the Bcl-2 family. Bcl-2 family proteins regulate and contribute to programmed cell death or apoptosis. It is a large protein family and all members contain at least one of four BH (bcl-2 homology) domains. Certain members such as Bcl-2, Bcl-xl and Mcl1 are anti-apoptotic, whilst others are pro-apoptotic. Most Bcl-2 family members contain a C-terminal transmembrane domain that functions to target these proteins to the outer mitochondrial and other intracellular membranes. It is expressed in a variety of tissues. BCL2 blocks the apoptotic death of some cells such as lymphocytes. It also regulates cell death by controlling the mitochondrial membrane permeability and inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Two transcript variants, produced by alternate splicing, differ in their C-terminal ends.
References
  • Tsujimoto Y, et al. (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science. 226(4678):1097-99.
  • Cleary ML, et al. (1986) Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell. 47(1):19-28.
  • Otake Y, et al. (2007) Overexpression of nucleolin in chronic lymphocytic leukemia cells induces stabilization of Bcl-2 / Bcl-2 mRNA. Blood. 109(7):3069-75.
  • TOP