Human BCL2/Bcl-2 transcript variant alpha Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGA771-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
720bp
Gene Synonym
BCL2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human B-cell CLL/lymphoma 2, nuclear gene encoding mitochondrial protein, transcript variant alpha Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
KpnI + XbaI (6kb + 0.77kb)
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BCL2 (B-cell leukemia/lymphoma 2, N-Histidine-tagged), also known as Bcl-2, belongs to the Bcl-2 family. Bcl-2 family proteins regulate and contribute to programmed cell death or apoptosis. It is a large protein family and all members contain at least one of four BH (bcl-2 homology) domains. Certain members such as Bcl-2, Bcl-xl and Mcl1 are anti-apoptotic, whilst others are pro-apoptotic. Most Bcl-2 family members contain a C-terminal transmembrane domain that functions to target these proteins to the outer mitochondrial and other intracellular membranes. It is expressed in a variety of tissues. BCL2 blocks the apoptotic death of some cells such as lymphocytes. It also regulates cell death by controlling the mitochondrial membrane permeability and inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Two transcript variants, produced by alternate splicing, differ in their C-terminal ends.
References
  • Tsujimoto Y, et al. (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science. 226(4678):1097-99.
  • Cleary ML, et al. (1986) Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell. 47(1):19-28.
  • Otake Y, et al. (2007) Overexpression of nucleolin in chronic lymphocytic leukemia cells induces stabilization of Bcl-2 / Bcl-2 mRNA. Blood. 109(7):3069-75.
  • TOP