Human ALK-2/ACVR1 transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_001111067.2

RefSeq ORF Size

1530bp

Gene Synonym

ACVR1, FOPA, ALK2, SKR1, TSRI, ACTRI, ACVR1A, ACVRLK2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human activin A receptor, type I (ACVR1), transcript variant 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ALK-2, also termed as ACVR1, was initially identified as an activin type I receptor because of its ability to bind activin in concert with ActRII or ActRIIB. ALK-2 is also identified as a BMP type I receptor. It has been demonstrated that ALK-2 forms complex with either the BMP-2/7-bound BMPR-II or ACVR2A /ACVR2B. ALK-1 and ALK-2 presenting in the yeast Saccharomyces cerevisiae are two haspin homologues. Both ALK-1 and ALK-2 exhibit a weak auto-kinase activity in vitro, and are phosphoproteins in vivo. ALK-1 and ALK-2 levels peak in mitosis and late-S/G2. Control of protein stability plays a major role in ALK-2 regulation. The half-life of ALK-2 is particularly short in G1. Overexpression of ALK-2, but not of ALK-1, causes a mitotic arrest, which is correlated to the kinase activity of the protein. This suggests a role for ALK-2 in the control of mitosis. Endoglin is phosphorylated on cytosolic domain threonine residues by the TGF-beta type I receptors ALK-2 and ALK-5 in prostate cancer cells. Endoglin did not inhibit cell migration in the presence of constitutively active ALK-2. Defects in ALK-2 are a cause of fibrodysplasia ossificans progressiva (FOP).

References

Armes NA,et al. (1997) The ALK-2 and ALK-4 activin receptors transduce distinct mesoderm-inducing signals during early Xenopus development but do not co-operate to establish thresholds. Development 124(19): 3797-804.

Armes NA, et al. (1999) A short loop on the ALK-2 and ALK-4 activin receptors regulates signaling specificity but cannot account for all their effects on early Xenopus development. J Biol Chem. 274(12):7929-35.

Kawai S, et al. (2000) Mouse smad8 phosphorylation downstream of BMP receptors ALK-2, ALK-3, and ALK-6 induces its association with Smad4 and transcriptional activity.Biochem Biophys Res Commun. 271(3):682-7.

Deng Y, et al. (2009) Efficient highly selective synthesis of methyl 2-(ethynyl)alk-2(E)-enoates and 2-(1'-chlorovinyl)alk-2(Z)-enoates from 2-(methoxycarbonyl)-2,3-allenols. Organic letters 11(10):2169-72.

Catalog Number:HGA344-CF