Human ABHD14B Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGA094-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
633bp
Gene Synonym
CIB
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human abhydrolase domain containing 14B Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ABHD14B belongs to the AB hydrolase superfamily, ABHD14 family. It can be detected in spleen, thymus, prostate, testis, ovary, small intestine, colon, peripheral blood leukocyte, heart, placenta, lung, liver, skeletal muscle, pancreas and kidney. ABHD14B has hydrolase activity towards p-nitrophenyl butyrate (in vitro) and may interact with TAF1. It may activate transcription. Recombinant human ABHD14B protein, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography techniques. ABHD14B contains an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. In molecular biology, the alpha/beta hydrolase fold is common to a number of hydrolytic enzymes of widely differing phylogenetic origin and catalytic function. The Ab hydrolase domain containing gene subfamily is comprised of 15 mostly uncharacterized members.
References
  • Mehrle A, et al. (2006) The LIFEdb database in 2006. Nucleic Acids Res. 34:D415-8.
  • Wan D, et al. (2004) Large-scale cDNA transfection screening for genes related to cancer development and progression. Proc Natl Acad Sci. 101(44):15724-9.
  • Wiemann S, et al. (2004) From ORFeome to biology: a functional genomics pipeline. Genome Res. 14 (10B):2136-44.
  • TOP