Human ABHD14B Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGA094-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
633bp
Gene Synonym
CIB
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human abhydrolase domain containing 14B Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ABHD14B belongs to the AB hydrolase superfamily, ABHD14 family. It can be detected in spleen, thymus, prostate, testis, ovary, small intestine, colon, peripheral blood leukocyte, heart, placenta, lung, liver, skeletal muscle, pancreas and kidney. ABHD14B has hydrolase activity towards p-nitrophenyl butyrate (in vitro) and may interact with TAF1. It may activate transcription. Recombinant human ABHD14B protein, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography techniques. ABHD14B contains an alpha/beta hydrolase fold, which is a catalytic domain found in a very wide range of enzymes. In molecular biology, the alpha/beta hydrolase fold is common to a number of hydrolytic enzymes of widely differing phylogenetic origin and catalytic function. The Ab hydrolase domain containing gene subfamily is comprised of 15 mostly uncharacterized members.
References
  • Mehrle A, et al. (2006) The LIFEdb database in 2006. Nucleic Acids Res. 34:D415-8.
  • Wan D, et al. (2004) Large-scale cDNA transfection screening for genes related to cancer development and progression. Proc Natl Acad Sci. 101(44):15724-9.
  • Wiemann S, et al. (2004) From ORFeome to biology: a functional genomics pipeline. Genome Res. 14 (10B):2136-44.
  • TOP