Human ABHD10 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGA090-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
921bp
Gene Synonym
ABHD10
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human abhydrolase domain containing 10 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Mycophenolic acid (MPA), the active metabolite of the immunosuppressant mycophenolate mofetil (MMF), is primarily metabolized by glucuronidation to a phenolic glucuronide (MPAG) and an acyl glucuronide (AcMPAG). It is known that AcMPAG, which may be an immunotoxic metabolite, is deglucuronidated in human liver. AcMPAG deglucuronidation activity was detected in both human liver cytosol (HLC) and microsomes (HLM). By purification from HLC with column chromatographic purification steps, the enzyme responsible for AcMPAG deglucuronidationis identified as α/β hydrolase domain containing 10 (ABHD10). Recombinant ABHD10 expressed in Sf9 cells efficiently deglucuronidated AcMPAG with a K(m) value of 100.7 ± 10.2 μM, which was similar to those in HLM, HLC, and human liver homogenates (HLH). Immunoblot analysis revealed ABHD10 protein expression in both HLC and HLM. The AcMPAG deglucuronidation by recombinant ABHD10, HLC, and HLH were potently inhibited by AgNO(3), CdCl(2), CuCl(2), PMSF, bis-p-nitrophenylphosphate, and DTNB. The CL(int) value of AcMPAG formation from MPA, which was catalyzed by human UGT2B7, in HLH was increased by 1.8-fold in the presence of PMSF. Thus, human ABHD10 would affect the formation of AcMPAG, the immunotoxic metabolite.
References
  • Nardini M. et al., 1999, Curr Opin Struct Biol. 9 (6): 732-7.
  • Carr PD. et al., 2009, Protein Pept Lett. 16 (10): 1137-48.
  • Cheah E. et al., 1992, Protein Eng. 5 (3): 197-211.
  • Iwamura A. et al., 2012, J Biol Chem. 287 (12): 9240-9.
  • TOP