Human ABHD10 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

BC014516

RefSeq ORF Size

921bp

Gene Synonym

ABHD10

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human abhydrolase domain containing 10 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Mycophenolic acid (MPA), the active metabolite of the immunosuppressant mycophenolate mofetil (MMF), is primarily metabolized by glucuronidation to a phenolic glucuronide (MPAG) and an acyl glucuronide (AcMPAG). It is known that AcMPAG, which may be an immunotoxic metabolite, is deglucuronidated in human liver. AcMPAG deglucuronidation activity was detected in both human liver cytosol (HLC) and microsomes (HLM). By purification from HLC with column chromatographic purification steps, the enzyme responsible for AcMPAG deglucuronidationis identified as α/β hydrolase domain containing 10 (ABHD10). Recombinant ABHD10 expressed in Sf9 cells efficiently deglucuronidated AcMPAG with a K(m) value of 100.7 ± 10.2 μM, which was similar to those in HLM, HLC, and human liver homogenates (HLH). Immunoblot analysis revealed ABHD10 protein expression in both HLC and HLM. The AcMPAG deglucuronidation by recombinant ABHD10, HLC, and HLH were potently inhibited by AgNO(3), CdCl(2), CuCl(2), PMSF, bis-p-nitrophenylphosphate, and DTNB. The CL(int) value of AcMPAG formation from MPA, which was catalyzed by human UGT2B7, in HLH was increased by 1.8-fold in the presence of PMSF. Thus, human ABHD10 would affect the formation of AcMPAG, the immunotoxic metabolite.

References

Nardini M. et al., 1999, Curr Opin Struct Biol. 9 (6): 732-7.

Carr PD. et al., 2009, Protein Pept Lett. 16 (10): 1137-48.

Cheah E. et al., 1992, Protein Eng. 5 (3): 197-211.

Iwamura A. et al., 2012, J Biol Chem. 287 (12): 9240-9.

Catalog Number:HGA090-CF