Human 2B4 / CD244 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGA039-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1098bp
Gene Synonym
2B4, CD244, NAIL, Nmrk, NKR2B4, SLAMF4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD244 molecule, natural killer cell receptor 2B4 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
The CD244 antigen, also known as 2B4, is a cell surface glycoprotein implicated in the regulation of natural killer and T lymphocyte function. 2B4 is a member of the signaling lymphocyte activation molecule (SLAM)-related receptor family and is important for stimulating NK cell cytotoxicity and cytokine production, which is expressed on all NK cells, a subpopulation of T cells, monocytes and basophils. The 2B4 antigen identified on NK cells and T cells is capable of transmitting stimulatory signals and non-MHC-restricted killing. Reported as an activating receptor, human 2B4 can effectively activate and enhance NK cell–mediated cytotoxicity, induce secretion of IFN-γ and matrix metalloproteinases (MMPs), as well as NK cell invasiveness. As a cell surface glycoprotein of the Ig-superfamily structurally related to CD2-like molecules such as CD2, CD48, CD58, CD84, Ly-9, and SLAM, 2B4 (CD244) is expressed on all human NK cells, a subpopulation of T cells, basophils and monocytes. 2B4 activates NK cell mediated cytotoxicity, induces secretion of IFN-gamma and matrix metalloproteinases, and NK cell invasiveness.
References
  • Nakajima H, et al. (2000) 2B4: an NK cell activating receptor with unique specificity and signal transduction mechanism. Hum Immunol. 61(1): 39-43.
  • Chuang SS, et al. (2001) 2B4 (CD244)-mediated activation of cytotoxicity and IFN-gamma release in human NK cells involves distinct pathways. J Immunol. 167(11): 6210-6.
  • McNerney ME, et al. (2005) 2B4 (CD244) is a non-MHC binding receptor with multiple functions on natural killer cells and CD8+ T cells. Mol Immunol. 42(4): 489-94.
  • Mathew SO, et al. (2009) Functional role of human NK cell receptor 2B4 (CD244) isoforms. Eur J Immunol. 39(6): 1632-41.
  • TOP