Human 2B4 / CD244 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_016382.2

RefSeq ORF Size

1098bp

Gene Synonym

2B4, CD244, NAIL, Nmrk, NKR2B4, SLAMF4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human CD244 molecule, natural killer cell receptor 2B4 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The CD244 antigen, also known as 2B4, is a cell surface glycoprotein implicated in the regulation of natural killer and T lymphocyte function. 2B4 is a member of the signaling lymphocyte activation molecule (SLAM)-related receptor family and is important for stimulating NK cell cytotoxicity and cytokine production, which is expressed on all NK cells, a subpopulation of T cells, monocytes and basophils. The 2B4 antigen identified on NK cells and T cells is capable of transmitting stimulatory signals and non-MHC-restricted killing. Reported as an activating receptor, human 2B4 can effectively activate and enhance NK cell–mediated cytotoxicity, induce secretion of IFN-γ and matrix metalloproteinases (MMPs), as well as NK cell invasiveness. As a cell surface glycoprotein of the Ig-superfamily structurally related to CD2-like molecules such as CD2, CD48, CD58, CD84, Ly-9, and SLAM, 2B4 (CD244) is expressed on all human NK cells, a subpopulation of T cells, basophils and monocytes. 2B4 activates NK cell mediated cytotoxicity, induces secretion of IFN-gamma and matrix metalloproteinases, and NK cell invasiveness.

References

Nakajima H, et al. (2000) 2B4: an NK cell activating receptor with unique specificity and signal transduction mechanism. Hum Immunol. 61(1): 39-43.

Chuang SS, et al. (2001) 2B4 (CD244)-mediated activation of cytotoxicity and IFN-gamma release in human NK cells involves distinct pathways. J Immunol. 167(11): 6210-6.

McNerney ME, et al. (2005) 2B4 (CD244) is a non-MHC binding receptor with multiple functions on natural killer cells and CD8+ T cells. Mol Immunol. 42(4): 489-94.

Mathew SO, et al. (2009) Functional role of human NK cell receptor 2B4 (CD244) isoforms. Eur J Immunol. 39(6): 1632-41.

Catalog Number:HGA039-CM