Canine FGF14/SCA27 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:DGC798-NF

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
759bp
Gene Synonym
FGF14
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Canine fibroblast growth factor 14 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FGF14 is a member of the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF14 is probably involved in nervous system development and function. Defects in FGF14 are the cause of spinocerebellar ataxia type 27 (SCA27). It is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA27 is an autosomal dominant cerebellar ataxia. It is a slowly progressive disorder, with onset in late-childhood to early adulthood, characterized by ataxia with tremor, orofacial dyskinesia, psychiatric symptoms and cognitive deficits.
References
  • Wang Q, et al. (2002) Ataxia and paroxysmal dyskinesia in mice lacking axonally transported FGF14. Neuron. 35 (1): 25-38.
  • Zhao Y, et al. (2007) Genetic analysis of SCA 27 in ataxia and childhood onset postural tremor. Am J Med Genet. 144B (3): 395-6.
  • Lou JY, et al. (2005) Fibroblast growth factor 14 is an intracellular modulator of voltage-gated sodium channels. J Physiol. 569 (1): 179-93.
  • TOP