Canine FGF14/SCA27 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Canine

NCBI Ref Seq

XM_003433069.1

RefSeq ORF Size

759bp

Gene Synonym

FGF14

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine fibroblast growth factor 14 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

FGF14 is a member of the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF14 is probably involved in nervous system development and function. Defects in FGF14 are the cause of spinocerebellar ataxia type 27 (SCA27). It is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA27 is an autosomal dominant cerebellar ataxia. It is a slowly progressive disorder, with onset in late-childhood to early adulthood, characterized by ataxia with tremor, orofacial dyskinesia, psychiatric symptoms and cognitive deficits.

References

Wang Q, et al. (2002) Ataxia and paroxysmal dyskinesia in mice lacking axonally transported FGF14. Neuron. 35 (1): 25-38.

Zhao Y, et al. (2007) Genetic analysis of SCA 27 in ataxia and childhood onset postural tremor. Am J Med Genet. 144B (3): 395-6.

Lou JY, et al. (2005) Fibroblast growth factor 14 is an intracellular modulator of voltage-gated sodium channels. J Physiol. 569 (1): 179-93.

Catalog Number:DGC798-CY