Canine BCA-1 / CXCL13 Gene ORF cDNA clone expression plasmid,N terminal His tag

Gene

Species

Canine

NCBI Ref Seq

XM_845089.2

RefSeq ORF Size

333bp

Gene Synonym

CXCL13

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine chemokine (C-X-C motif) ligand 13 Gene ORF cDNA clone expression plasmid,N terminal His tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-His

Restriction Site

Protein Tag

His

Tag Sequence

CACCATCACCACCATCATCACCACCATCAC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The chemokine CXCL13, also known as BCA-1 (B-cell-attracting chemokine-1) or BLC (B-lymphocyte chemoattractant), which belongs to the CXC chemokine family. CXCL13 and its receptor CXCR5 control the organization of B cells within follicles of lymphoid tissues. CXCL13 is known to dictate homing and motility of B cells in lymphoid tissue and has been implicated in the formation of ectopic lymphoid tissue in chronic inflammation. It involves in B-cell compartmental homing within secondary lymphoid organs and recently implicated in the pathogenesis of inflammatory and malignant lymphocyte-mediated diseases. In Primary central nervous system lymphoma (PCNSL), expression of BCA-1 by malignant lymphocytes and vascular endothelium may influence tumor development and localization to central nervous system (CNS). In T-lymphocytes, CXCL13 expression is thought to reflect a germinal center origin of the T-cell. CXCL13 expression may also provide an additional useful tool for the diagnosis of Angioimmunoblastic T-cell lymphoma (AITL).

References

Ansel KM, et al. (2000) A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature. 406 (6793): 309-14.

Smith JR, et al. (2003) Expression of B-cell-attracting chemokine 1 (CXCL13) by malignant lymphocytes and vascular endothelium in primary central nervous system lymphoma. Blood. 101(3): 815-21.

Dupuis J, et al. (2006) Expression of CXCL13 by neoplastic cells in angioimmunoblastic T-cell lymphoma (AITL): a new diagnostic marker providing evidence that AITL derives from follicular helper T cells. Am J Surg Pathol. 30(4): 490-4.

de Leval L, et al. (2007) The gene expression profile of nodal peripheral T-cell lymphoma demonstrates a molecular link between angioimmunoblastic T-cell lymphoma (AITL) and follicular helper T (TFH) cells. Blood. 109 (11): 4952-63.

Schiffer L, et al. (2009) B-cell-attracting chemokine CXCL13 as a marker of disease activity and renal involvement in systemic lupus erythematosus (SLE). Nephrol Dial Transplant. 24(12): 3708-12.

Rupprecht TA, et al. (2009) The chemokine CXCL13 is a key regulator of B cell recruitment to the cerebrospinal fluid in acute Lyme neuroborreliosis. J Neuroinflammation. 6: 42.

Catalog Number:DGA758-NH