Canine BCA-1 / CXCL13 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Canine

NCBI Ref Seq

XM_845089.2

RefSeq ORF Size

333bp

Gene Synonym

CXCL13

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine chemokine (C-X-C motif) ligand 13 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The chemokine CXCL13, also known as BCA-1 (B-cell-attracting chemokine-1) or BLC (B-lymphocyte chemoattractant), which belongs to the CXC chemokine family. CXCL13 and its receptor CXCR5 control the organization of B cells within follicles of lymphoid tissues. CXCL13 is known to dictate homing and motility of B cells in lymphoid tissue and has been implicated in the formation of ectopic lymphoid tissue in chronic inflammation. It involves in B-cell compartmental homing within secondary lymphoid organs and recently implicated in the pathogenesis of inflammatory and malignant lymphocyte-mediated diseases. In Primary central nervous system lymphoma (PCNSL), expression of BCA-1 by malignant lymphocytes and vascular endothelium may influence tumor development and localization to central nervous system (CNS). In T-lymphocytes, CXCL13 expression is thought to reflect a germinal center origin of the T-cell. CXCL13 expression may also provide an additional useful tool for the diagnosis of Angioimmunoblastic T-cell lymphoma (AITL).

References

Ansel KM, et al. (2000) A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature. 406 (6793): 309-14.

Smith JR, et al. (2003) Expression of B-cell-attracting chemokine 1 (CXCL13) by malignant lymphocytes and vascular endothelium in primary central nervous system lymphoma. Blood. 101(3): 815-21.

Dupuis J, et al. (2006) Expression of CXCL13 by neoplastic cells in angioimmunoblastic T-cell lymphoma (AITL): a new diagnostic marker providing evidence that AITL derives from follicular helper T cells. Am J Surg Pathol. 30(4): 490-4.

de Leval L, et al. (2007) The gene expression profile of nodal peripheral T-cell lymphoma demonstrates a molecular link between angioimmunoblastic T-cell lymphoma (AITL) and follicular helper T (TFH) cells. Blood. 109 (11): 4952-63.

Schiffer L, et al. (2009) B-cell-attracting chemokine CXCL13 as a marker of disease activity and renal involvement in systemic lupus erythematosus (SLE). Nephrol Dial Transplant. 24(12): 3708-12.

Rupprecht TA, et al. (2009) The chemokine CXCL13 is a key regulator of B cell recruitment to the cerebrospinal fluid in acute Lyme neuroborreliosis. J Neuroinflammation. 6: 42.

Catalog Number:DGA758-CO