Cynomolgus TEM7/PLXDC1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:CGH657-NF

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1503bp
Gene Synonym
PLXDC1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Cynomolgus plexin domain containing 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Plexin domain-containing protein 1, also known as tumor endothelial marker 3, tumor endothelial marker 7 and PLXDC1 and TEM3, is a secreted, cytoplasm and single-pass type I membrane protein which belongs to the plexin family. PLXDC1 / TEM3 is detected in endothelial cells from colorectal cancer, and in endothelial cells from primary cancers of the lung, liver, pancreas, breast and brain. It is expressed in fibrovascular membrane with increased expression in individuals with proliferative diabetic retinopathy. PLXDC1 / TEM3 is not detectable in endothelial cells from normal tissue. PLXDC1 / TEM3 plays a critical role in endothelial cell capillary morphogenesis. PLXDC1 / TEM3 may play a significant role in the proliferation and maintenance of neovascular endothelial cells in the formation of fibrovascular membranes (FVMs). PLXDC1 / TEM3 may be a molecular target for new diagnostic and therapeutic strategies for proliferative diabetic retinopathy (PDR). PLXDC1 / TEM3 interacts with NID1. It may also interact with CTTN.
References
  • Beaty,R.M. et al., 2007,J Neurooncol. 81 (3):241-8.
  • Miller,S.F. et al., 2007, Gene Expr Patterns. 7 (5):635-44.
  • Yamaji,Y. et al., 2008, Invest Ophthalmol Vis Sci. 49 (7):3151-7.
  • TOP