Cynomolgus TEM7/PLXDC1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:CGH657-CM

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1503bp
Gene Synonym
PLXDC1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Cynomolgus plexin domain containing 1 Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Plexin domain-containing protein 1, also known as tumor endothelial marker 3, tumor endothelial marker 7 and PLXDC1 and TEM3, is a secreted, cytoplasm and single-pass type I membrane protein which belongs to the plexin family. PLXDC1 / TEM3 is detected in endothelial cells from colorectal cancer, and in endothelial cells from primary cancers of the lung, liver, pancreas, breast and brain. It is expressed in fibrovascular membrane with increased expression in individuals with proliferative diabetic retinopathy. PLXDC1 / TEM3 is not detectable in endothelial cells from normal tissue. PLXDC1 / TEM3 plays a critical role in endothelial cell capillary morphogenesis. PLXDC1 / TEM3 may play a significant role in the proliferation and maintenance of neovascular endothelial cells in the formation of fibrovascular membranes (FVMs). PLXDC1 / TEM3 may be a molecular target for new diagnostic and therapeutic strategies for proliferative diabetic retinopathy (PDR). PLXDC1 / TEM3 interacts with NID1. It may also interact with CTTN.
References
  • Beaty,R.M. et al., 2007,J Neurooncol. 81 (3):241-8.
  • Miller,S.F. et al., 2007, Gene Expr Patterns. 7 (5):635-44.
  • Yamaji,Y. et al., 2008, Invest Ophthalmol Vis Sci. 49 (7):3151-7.
  • TOP