Cynomolgus Opalin / TMEM10 Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Catalog Number:CGF490-NG

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
426bp
Gene Synonym
OPALIN
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Cynomolgus oligodendrocytic myelin paranodal and inner loop protein Gene ORF cDNA clone expression plasmid,N terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Opalin, or oligodendrocytic myelin paranodal and inner loop protein, is a transmembrane protein detected specifically in mammalian oligodendrocytes, and may play significant role in oligodendrocyte differentiation and myelination.Opalin has binding sites for Myt1 and cAMP-response element binding protein (CREB). Over-expression of Myt1, treatment of the cell with leukemia inhibitory factor (LIF), and cAMP analog (CREB activator) enhanced the expression of endogenous Opalin in Oli-neu cells and activated the oligodendrocyte enhancer. Thus LIF, cAMP signaling cascades and Myt1 may play significant roles in the differentiation of oligodendrocytes through their action on the Opalin oligodendrocyte enhancer. Enzymatic deglycosylation showed that myelin Opalin contained N- and O-glycans, and that the O-glycans, at least, had negatively charged sialic acids. Site-directed mutations at the glycan sites impaired the cell surface localization of Opalin. In addition to the somata and processes of oligodendrocytes, Opalin immunoreactivity was observed in myelinated axons in a spiral fashion, and was concentrated in the paranodal loop region. Immunogold electron microscopy demonstrated that Opalin was localized at particular sites in the paranodal loop membrane. These results suggest a role for highly sialylglycosylated Opalin in an intermembranous function of the myelin paranodal loops in the central nervous system.
References
  • Aruga J, et al. (2007) An oligodendrocyte enhancer in a phylogenetically conserved intron region of the mammalian myelin gene Opalin. J Neurochem. 102(5):1533-47.
  • Kippert A, et al. (2008) Identification of Tmem10/Opalin as a novel marker for oligodendrocytes using gene expression profiling. BMC Neurosci. 9:40.
  • Yoshikawa F, et al. (2008) Opalin, a transmembrane sialylglycoprotein located in the central nervous system myelin paranodal loop membrane. J Biol Chem. 83(30):20830-40.
  • Golan N, et al. (2008) Identification of Tmem10/Opalin as an oligodendrocyte enriched gene using expression profiling combined with genetic cell ablation. Glia. 56(11):1176-86.
  • TOP