Cynomolgus Opalin / TMEM10 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Cynomolgus

NCBI Ref Seq

XM_005566083.1

RefSeq ORF Size

426bp

Gene Synonym

OPALIN

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Cynomolgus oligodendrocytic myelin paranodal and inner loop protein Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Opalin, or oligodendrocytic myelin paranodal and inner loop protein, is a transmembrane protein detected specifically in mammalian oligodendrocytes, and may play significant role in oligodendrocyte differentiation and myelination.Opalin has binding sites for Myt1 and cAMP-response element binding protein (CREB). Over-expression of Myt1, treatment of the cell with leukemia inhibitory factor (LIF), and cAMP analog (CREB activator) enhanced the expression of endogenous Opalin in Oli-neu cells and activated the oligodendrocyte enhancer. Thus LIF, cAMP signaling cascades and Myt1 may play significant roles in the differentiation of oligodendrocytes through their action on the Opalin oligodendrocyte enhancer. Enzymatic deglycosylation showed that myelin Opalin contained N- and O-glycans, and that the O-glycans, at least, had negatively charged sialic acids. Site-directed mutations at the glycan sites impaired the cell surface localization of Opalin. In addition to the somata and processes of oligodendrocytes, Opalin immunoreactivity was observed in myelinated axons in a spiral fashion, and was concentrated in the paranodal loop region. Immunogold electron microscopy demonstrated that Opalin was localized at particular sites in the paranodal loop membrane. These results suggest a role for highly sialylglycosylated Opalin in an intermembranous function of the myelin paranodal loops in the central nervous system.

References

Aruga J, et al. (2007) An oligodendrocyte enhancer in a phylogenetically conserved intron region of the mammalian myelin gene Opalin. J Neurochem. 102(5):1533-47.

Kippert A, et al. (2008) Identification of Tmem10/Opalin as a novel marker for oligodendrocytes using gene expression profiling. BMC Neurosci. 9:40.

Yoshikawa F, et al. (2008) Opalin, a transmembrane sialylglycoprotein located in the central nervous system myelin paranodal loop membrane. J Biol Chem. 83(30):20830-40.

Golan N, et al. (2008) Identification of Tmem10/Opalin as an oligodendrocyte enriched gene using expression profiling combined with genetic cell ablation. Glia. 56(11):1176-86.

Catalog Number:CGF490-NF