Rhesus H1F0/Histone H1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:CGD378-NM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
585bp
Gene Synonym
H1F0
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus H1 histone family, member 0 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
H1 histone family, member 0 (H1F0) is a member of the H1 histone family of nuclear proteins which are a component of chromatin in eukaryotic cells. It's involved in maintaining the structure of chromatin by packing the "beads on a string" sub-structure into a high order structure. The lysine-rich H1 histone family in mammals includes eleven members. In higher eukaryotes all H1 variants have the same general structure, consisting of a central conserved globular domain and less conserved N-terminal and C-terminal tails. These tails are moderately conserved among species, but differ among variants, suggesting a specific function for each H1 variant. Studies on the role of particular subtypes at specific developmental stages in lower eukaryotes, but also in vertebrates suggest that specific subtypes of H1 participate in particular systems of gene regulation. 
References
  • Ramakrishnan V, et al. (1993) Crystal structure of globular domain of histone H5 and its implications for nucleosome binding. Nature. 362 (6417): 219-23.
  • Happel N, et al. (2009) Histone H1 and its isoforms: contribution to chromatin structure and function. Gene. 431 (1-2): 1-12.
  • Izzo A, et al. (2008) The histone H1 family: specific members, specific functions. Biol Chem. 389 (4): 333-43.
  • TOP