Rhesus H1F0/Histone H1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:CGD378-CF

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
585bp
Gene Synonym
H1F0
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus H1 histone family, member 0 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
H1 histone family, member 0 (H1F0) is a member of the H1 histone family of nuclear proteins which are a component of chromatin in eukaryotic cells. It's involved in maintaining the structure of chromatin by packing the "beads on a string" sub-structure into a high order structure. The lysine-rich H1 histone family in mammals includes eleven members. In higher eukaryotes all H1 variants have the same general structure, consisting of a central conserved globular domain and less conserved N-terminal and C-terminal tails. These tails are moderately conserved among species, but differ among variants, suggesting a specific function for each H1 variant. Studies on the role of particular subtypes at specific developmental stages in lower eukaryotes, but also in vertebrates suggest that specific subtypes of H1 participate in particular systems of gene regulation. 
References
  • Ramakrishnan V, et al. (1993) Crystal structure of globular domain of histone H5 and its implications for nucleosome binding. Nature. 362 (6417): 219-23.
  • Happel N, et al. (2009) Histone H1 and its isoforms: contribution to chromatin structure and function. Gene. 431 (1-2): 1-12.
  • Izzo A, et al. (2008) The histone H1 family: specific members, specific functions. Biol Chem. 389 (4): 333-43.
  • TOP