Rat EDAR/Ectodysplasin A Receptor Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_001191899.1

RefSeq ORF Size

1347bp

Gene Synonym

RGD1561714, Edar

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat ectodysplasin-A receptor Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tumor necrosis factor receptor superfamily member EDAR is a Single-pass type I membrane protein. Edar was expressed reiteratively in signaling centers regulating key steps in morphogenesis. activin signaling from mesenchyme induces the expression of the TNF receptor edar in the epithelial signaling centers, thus making them responsive to Wnt-induced ectodysplasin from the nearby ectoderm. This is the first demonstration of integration of the Wnt, activin, and TNF signaling pathways. Defects in EDAR are a cause of ectodermal dysplasia anhidrotic (EDA), also known ectodermal dysplasia hypohidrotic autosomal recessive (HED). Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EDA is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands.

References

Elomaa O, et al. (2001) Ectodysplasin is released by proteolytic shedding and binds to the EDAR protein. Hum Mol Genet. 10 (9): 953-62.

Koppinen P, et al. (2001) Signaling and subcellular localization of the TNF receptor Edar. Exp Cell Res. 269 (2): 180-92.

Chassaing N, et al. (2006) Mutations in EDAR account for one-quarter of non-ED1-related hypohidrotic ectodermal dysplasia. Hu. Mutat. 27 (3): 255-9.

Catalog Number:CGC378-NO