Rat EDAR/Ectodysplasin A Receptor Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001191899.1

RefSeq ORF Size

1347bp

Gene Synonym

RGD1561714, Edar

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat ectodysplasin-A receptor Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tumor necrosis factor receptor superfamily member EDAR is a Single-pass type I membrane protein. Edar was expressed reiteratively in signaling centers regulating key steps in morphogenesis. activin signaling from mesenchyme induces the expression of the TNF receptor edar in the epithelial signaling centers, thus making them responsive to Wnt-induced ectodysplasin from the nearby ectoderm. This is the first demonstration of integration of the Wnt, activin, and TNF signaling pathways. Defects in EDAR are a cause of ectodermal dysplasia anhidrotic (EDA), also known ectodermal dysplasia hypohidrotic autosomal recessive (HED). Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EDA is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands.

References

Elomaa O, et al. (2001) Ectodysplasin is released by proteolytic shedding and binds to the EDAR protein. Hum Mol Genet. 10 (9): 953-62.

Koppinen P, et al. (2001) Signaling and subcellular localization of the TNF receptor Edar. Exp Cell Res. 269 (2): 180-92.

Chassaing N, et al. (2006) Mutations in EDAR account for one-quarter of non-ED1-related hypohidrotic ectodermal dysplasia. Hu. Mutat. 27 (3): 255-9.

Catalog Number:CGC378-CY