Rhesus CD84 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001117591.2

RefSeq ORF Size

987bp

Gene Synonym

CD84

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus CD84 molecule Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The CD2 family receptors are type I transmembrane glycoproteins belonging to immunoglobulin (Ig) superfamily characterized by a membrane-proximal Ig constant 2 (C2) domain and a membrane-distal variable (V) domain that is responsible for ligand recognition. CD84, also known as LY9B and SLAMF5, is a homophilic member of the SLAM (signaling lymphocyte activation molecule) subfamily of the CD2 family. The SLAM family receptorsmediate signal transduction through the interaction of its ITSM (immunoreceptor tyrosine-based switch motifs) in the intracellular region and the SH2 domain of adaptor molecules SAP (SLAM-associated protein) and EAT-2 (EWS-activated transcript 2), and accordingly modulate both adaptive and innate immune responses. The CD84-CD84 interaction was independent of its cytoplasmic tail. Thus, CD84 is its own ligand and acts as a costimulatory molecule. CD84 is expressed on cells from almost all hematopoietic lineages and on CD34+ hematopoietic progenitor cells, suggesting that CD84 serves as a marker for committed hematopoietic progenitor cells.

References

Martin M, et al. (2001) CD84 functions as a homophilic adhesion molecule and enhances IFN-gamma secretion: adhesion is mediated by Ig-like domain 1. J Immunol. 167(7): 3668-76.

Tangye SG, et al. (2002) CD84 is up-regulated on a major population of human memory B cells and recruits the SH2 domain containing proteins SAP and EAT-2. Eur J Immunol. 32(6): 1640-9.

Zaiss M, et al. (2003) CD84 expression on human hematopoietic progenitor cells. Exp Hematol. 31(9): 798-805.

Tangye SG, et al. (2003) Functional requirements for interactions between CD84 and Src homology 2 domain-containing proteins and their contribution to human T cell activation. J Immunol. 171(5): 2485-95.

Yan Q, et al. (2007) Structure of CD84 provides insight into SLAM family function. Proc Natl Acad Sci U S A. 104(25): 10583-8.

Catalog Number:CGB393-NO