Rhesus CD84 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001117591.2

RefSeq ORF Size

987bp

Gene Synonym

CD84

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus CD84 molecule Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The CD2 family receptors are type I transmembrane glycoproteins belonging to immunoglobulin (Ig) superfamily characterized by a membrane-proximal Ig constant 2 (C2) domain and a membrane-distal variable (V) domain that is responsible for ligand recognition. CD84, also known as LY9B and SLAMF5, is a homophilic member of the SLAM (signaling lymphocyte activation molecule) subfamily of the CD2 family. The SLAM family receptorsmediate signal transduction through the interaction of its ITSM (immunoreceptor tyrosine-based switch motifs) in the intracellular region and the SH2 domain of adaptor molecules SAP (SLAM-associated protein) and EAT-2 (EWS-activated transcript 2), and accordingly modulate both adaptive and innate immune responses. The CD84-CD84 interaction was independent of its cytoplasmic tail. Thus, CD84 is its own ligand and acts as a costimulatory molecule. CD84 is expressed on cells from almost all hematopoietic lineages and on CD34+ hematopoietic progenitor cells, suggesting that CD84 serves as a marker for committed hematopoietic progenitor cells.

References

Martin M, et al. (2001) CD84 functions as a homophilic adhesion molecule and enhances IFN-gamma secretion: adhesion is mediated by Ig-like domain 1. J Immunol. 167(7): 3668-76.

Tangye SG, et al. (2002) CD84 is up-regulated on a major population of human memory B cells and recruits the SH2 domain containing proteins SAP and EAT-2. Eur J Immunol. 32(6): 1640-9.

Zaiss M, et al. (2003) CD84 expression on human hematopoietic progenitor cells. Exp Hematol. 31(9): 798-805.

Tangye SG, et al. (2003) Functional requirements for interactions between CD84 and Src homology 2 domain-containing proteins and their contribution to human T cell activation. J Immunol. 171(5): 2485-95.

Yan Q, et al. (2007) Structure of CD84 provides insight into SLAM family function. Proc Natl Acad Sci U S A. 104(25): 10583-8.

Catalog Number:CGB393-NM