Rhesus CD297 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:CGB324-CY

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
993bp
Gene Synonym
ART4
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus ADP-ribosyltransferase 4 (Dombrock blood group) Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ADP-ribosyltransferase 4 (Dombrock blood group), also known as Mono-ADP-ribosyltransferase 4(ART4), Dombrock blood group carrier molecule and CD297, is a protein that contains a mono-ADP-ribosylation (ART) motif. It is a member of the ADP-ribosyltransferase gene family but enzymatic activity has not been demonstrated experimentally. ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. ART4 could be detected on HEL cells and erythrocytes by FACS analysis while it was absent from activated monocytes, despite the presence of ART4 mRNA in these cells. ART is also known as the carrier of the Dombrock blood group alloantigens (Do) which is glycosylphosphatidylinosotol-anchored to the erythrocyte membrane.
References
  • Parusel I, et al. (2005) A panel of monoclonal antibodies recognizing GPI-anchored ADP-ribosyltransferase ART4, the carrier of the Dombrock blood group antigens. Cell Immunol. 236(1-2): 59-65.
  • Friedrich M, et al. (2005) Analysis of the 3' UTR of the ART3 and ART4 gene by 3' inverse RACE-PCR. DNA Seq. 16(1): 53-7.
  • Okazaki IJ, et al. (1998) Glycosylphosphatidylinositol-anchored and secretory isoforms of mono-ADP-ribosyltransferases. J Biol Chem. 273(37): 23617-20.
  • TOP