Rhesus CD297 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001090760.2

RefSeq ORF Size

993bp

Gene Synonym

ART4

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus ADP-ribosyltransferase 4 (Dombrock blood group) Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ADP-ribosyltransferase 4 (Dombrock blood group), also known as Mono-ADP-ribosyltransferase 4(ART4), Dombrock blood group carrier molecule and CD297, is a protein that contains a mono-ADP-ribosylation (ART) motif. It is a member of the ADP-ribosyltransferase gene family but enzymatic activity has not been demonstrated experimentally. ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. ART4 could be detected on HEL cells and erythrocytes by FACS analysis while it was absent from activated monocytes, despite the presence of ART4 mRNA in these cells. ART is also known as the carrier of the Dombrock blood group alloantigens (Do) which is glycosylphosphatidylinosotol-anchored to the erythrocyte membrane.

References

Parusel I, et al. (2005) A panel of monoclonal antibodies recognizing GPI-anchored ADP-ribosyltransferase ART4, the carrier of the Dombrock blood group antigens. Cell Immunol. 236(1-2): 59-65.

Friedrich M, et al. (2005) Analysis of the 3' UTR of the ART3 and ART4 gene by 3' inverse RACE-PCR. DNA Seq. 16(1): 53-7.

Okazaki IJ, et al. (1998) Glycosylphosphatidylinositol-anchored and secretory isoforms of mono-ADP-ribosyltransferases. J Biol Chem. 273(37): 23617-20.

Catalog Number:CGB324-CM