Rat CD247/CD3-ZETA Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:CGB318-NO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
495bp
Gene Synonym
Cd3z, TCRzeta, Cd247
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat Cd247 molecule Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD247, also known as CD3-ZETA, belongs to the CD3Z/FCER1G family. It contains 3 ITAM domains. As a -cell receptor zeta, CD247 forms the T-cell receptor-CD3 complex together with T-cell receptor alpha/beta and gamma/delta heterodimers, and with CD3-gamma, -delta and –epsilon. The zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. Low expression of the antigen results in impaired immune response. Two alternatively spliced transcript variants encoding distinct isoforms have been found for CD247 gene. Defects in CD247 can cause immunodeficiency due to defect in CD3-zeta. An immunological deficiency characterized by T-cells impaired immune response to alloantigens, tetanus toxoid and mitogens. CD247 may play a role in assembly and expression of the TCR complex as well as signal transduction upon antigen triggering.
References
  • 1. Radstake TR, et al. (2010) Genome-wide association study of systemic sclerosis identifies CD247 as a new susceptibility locus. Nat Genet. 42(5):426-9.
  • 2. Dieud P, et al. (2011) Independent replication establishes the CD247 gene as a genetic systemic sclerosis susceptibility factor. Ann Rheum Dis. 70(9):1695-6.
  • 3. Li R, et al. (2012) Association of CD247 with systemic lupus erythematosus in Asian populations. Lupus. 21(1):75-83.
  • TOP