Rat CD247/CD3-ZETA Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:CGB318-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
495bp
Gene Synonym
Cd3z, TCRzeta, Cd247
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat Cd247 molecule Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD247, also known as CD3-ZETA, belongs to the CD3Z/FCER1G family. It contains 3 ITAM domains. As a -cell receptor zeta, CD247 forms the T-cell receptor-CD3 complex together with T-cell receptor alpha/beta and gamma/delta heterodimers, and with CD3-gamma, -delta and –epsilon. The zeta chain plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. Low expression of the antigen results in impaired immune response. Two alternatively spliced transcript variants encoding distinct isoforms have been found for CD247 gene. Defects in CD247 can cause immunodeficiency due to defect in CD3-zeta. An immunological deficiency characterized by T-cells impaired immune response to alloantigens, tetanus toxoid and mitogens. CD247 may play a role in assembly and expression of the TCR complex as well as signal transduction upon antigen triggering.
References
  • 1. Radstake TR, et al. (2010) Genome-wide association study of systemic sclerosis identifies CD247 as a new susceptibility locus. Nat Genet. 42(5):426-9.
  • 2. Dieud P, et al. (2011) Independent replication establishes the CD247 gene as a genetic systemic sclerosis susceptibility factor. Ann Rheum Dis. 70(9):1695-6.
  • 3. Li R, et al. (2012) Association of CD247 with systemic lupus erythematosus in Asian populations. Lupus. 21(1):75-83.
  • TOP