Rhesus CD209/DC-SIGN Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:CGB312-NY

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1146bp
Gene Synonym
CD209
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus CD209 molecule Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Dendritic cell (DC)-specific intercellular adhesion molecule 3 (ICAM-3) grabbing nonintegrin (DC-SIGN), also known as CD209, is a type II transmembrane protein on DCs with a C-type lectin extracellular domain, is capable of binding ICAM-3 on resting T cells in the secondary lymphoid organs, providing the initial contact between these cells during the establishment of cell-mediated immunity. It is not only a pattern recognition receptor but implicated in immunoregulation of DCs. It has important role in mediating DC adhesion, migration, inflammation, activating primary T cell, triggering immune response and participating in immune escape of pathogens and tumors. DC-SIGN also mediates capture and internalization of viral, bacterial, and fungal pathogens by dendritic cells, such as HIV-1, Ebola virus, cytomegalovirus, Dengue virus, and hepatitis C virus. DC-SIGN is unique in that it regulates adhesion processes, such as DC trafficking and T-cell synapse formation, as well as antigen capture. Moreover, even though several C-type lectins have been shown to bind HIV-1, DC-SIGN does not only capture HIV-1 but also protects it in early endosomes allowing HIV-1 transport by DC to lymphoid tissues, where it enhances trans infection of T cells.
References
  • Geijtenbeek TB, et al. (2002) DC-SIGN, a C-type lectin on dendritic cells that unveils many aspects of dendritic cell biology. J Leukoc Biol. 71(6): 921-31.
  • Masso M. (2003) DC-SIGN points the way to a novel mechanism for HIV-1 transmission. MedGenMed. 5(2): 2.
  • Zhou T, et al. (2006) DC-SIGN and immunoregulation. Cell Mol Immunol. 3(4): 279-83.
  • TOP