Rhesus CD209/DC-SIGN Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:CGB312-NO

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1146bp
Gene Synonym
CD209
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus CD209 molecule Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Dendritic cell (DC)-specific intercellular adhesion molecule 3 (ICAM-3) grabbing nonintegrin (DC-SIGN), also known as CD209, is a type II transmembrane protein on DCs with a C-type lectin extracellular domain, is capable of binding ICAM-3 on resting T cells in the secondary lymphoid organs, providing the initial contact between these cells during the establishment of cell-mediated immunity. It is not only a pattern recognition receptor but implicated in immunoregulation of DCs. It has important role in mediating DC adhesion, migration, inflammation, activating primary T cell, triggering immune response and participating in immune escape of pathogens and tumors. DC-SIGN also mediates capture and internalization of viral, bacterial, and fungal pathogens by dendritic cells, such as HIV-1, Ebola virus, cytomegalovirus, Dengue virus, and hepatitis C virus. DC-SIGN is unique in that it regulates adhesion processes, such as DC trafficking and T-cell synapse formation, as well as antigen capture. Moreover, even though several C-type lectins have been shown to bind HIV-1, DC-SIGN does not only capture HIV-1 but also protects it in early endosomes allowing HIV-1 transport by DC to lymphoid tissues, where it enhances trans infection of T cells.
References
  • Geijtenbeek TB, et al. (2002) DC-SIGN, a C-type lectin on dendritic cells that unveils many aspects of dendritic cell biology. J Leukoc Biol. 71(6): 921-31.
  • Masso M. (2003) DC-SIGN points the way to a novel mechanism for HIV-1 transmission. MedGenMed. 5(2): 2.
  • Zhou T, et al. (2006) DC-SIGN and immunoregulation. Cell Mol Immunol. 3(4): 279-83.
  • TOP