Rhesus CD1B Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rhesus

NCBI Ref Seq

NM_001145534.1

RefSeq ORF Size

1002bp

Gene Synonym

CD1B

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus CD1b molecule Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD1B contains 1 Ig-like (immunoglobulin-like) domain and belongs to the CD1 family. CD1 family members are transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. During protein synthesis and maturation, they bind endogenous lipids that are replaced by lipid or glycolipid antigens when the proteins are internalized and pass through endosomes, before trafficking back to the cell surface. CD1B localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail, and requires vesicular acidification to bind lipid antigens.. It is expressed on cortical thymocytes, epidermal Langerhans cells, dendritic cells, on certain T-cell leukemias, and in various other tissues. CD1B is an antigen-presenting protein that binds self and non-self lipid and glycolipid antigens and presents them to T-cell receptors on natural killer T-cells.

References

Coventry B, et al. (2004) CD1a in human cancers: a new role for an old molecule. Trends Immunol. 25 (5):242-8.

Martin LH, et al. (1988) Structure and expression of the human thymocyte antigens CD1a, CD1b, and CD1c. Proc Natl Acad Sci. 84(24):9189-93.

Aruffo A, et al. (1989) Expression of cDNA clones encoding the thymocyte antigens CD1a, b, c demonstrates a hierarchy of exclusion in fibroblasts. J Immunol. 143(5):1723-30.

Longley J, et al. (1989) Molecular cloning of CD1a (T6), a human epidermal dendritic cell marker related to class I MHC molecules. J Invest Dermatol. 92(4):628-31.

Catalog Number:CGB298-NM