Rhesus CD1B Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:CGB298-CO

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1002bp
Gene Synonym
CD1B
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus CD1b molecule Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD1B contains 1 Ig-like (immunoglobulin-like) domain and belongs to the CD1 family. CD1 family members are transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. During protein synthesis and maturation, they bind endogenous lipids that are replaced by lipid or glycolipid antigens when the proteins are internalized and pass through endosomes, before trafficking back to the cell surface. CD1B localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail, and requires vesicular acidification to bind lipid antigens.. It is expressed on cortical thymocytes, epidermal Langerhans cells, dendritic cells, on certain T-cell leukemias, and in various other tissues. CD1B is an antigen-presenting protein that binds self and non-self lipid and glycolipid antigens and presents them to T-cell receptors on natural killer T-cells.
References
  • Coventry B, et al. (2004) CD1a in human cancers: a new role for an old molecule. Trends Immunol. 25 (5):242-8.
  • Martin LH, et al. (1988) Structure and expression of the human thymocyte antigens CD1a, CD1b, and CD1c. Proc Natl Acad Sci. 84(24):9189-93.
  • Aruffo A, et al. (1989) Expression of cDNA clones encoding the thymocyte antigens CD1a, b, c demonstrates a hierarchy of exclusion in fibroblasts. J Immunol. 143(5):1723-30.
  • Longley J, et al. (1989) Molecular cloning of CD1a (T6), a human epidermal dendritic cell marker related to class I MHC molecules. J Invest Dermatol. 92(4):628-31.
  • TOP