Rhesus BMPR2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001101663.2

RefSeq ORF Size

3117bp

Gene Synonym

BMPR2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus bone morphogenetic protein receptor, type II (serine/threonine kinase) Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The bone morphogenetic protein type II receptor (BMPR-II, or BMPR2), a receptor for the transforming growth factor (TGF)-beta/bone morphogenetic protein (BMP) superfamily. Reduced expression or function of BMPR2 signaling leads to exaggerated TGF-beta signaling and altered cellular responses to TGF-beta. In endothelial cells, BMPR2 mutation increases the susceptibility of cells to apoptosis. BMPR2 transduces BMP signals by forming heteromeric complexes with and phosphorylating BMP type I receptors. The intracellular domain of BMPR2 is both necessary and sufficient for receptor complex interaction. It had been identified that BMPR2 plays a key role in cell growth. Its mutations lead to hereditary pulmonary hypertension, and knockout of Bmpr-II results in early embryonic lethality. The C-terminal tail of BMPR2 provides binding sites for a number of regulatory proteins that may initiate Smad-independent signalling. BMPR2 mutations were predicted to alter the BMP and TGF-b1/SMAD signalling pathways, resulting in proliferation rather than apoptosis of vascular cells, and greatly increase the risk of developing severe pulmonary arterial hypertension. BMPR2 gene result in familial Primary pulmonary hypertension (PPH) transmitted as an autosomal dominant trait, albeit with low penetrance. Heterozygous germline mutations of BMPR2 gene have been identified in patients with familial and sporadic PPH, indicating that BMPR2 may contribute to the maintenance of normal pulmonary vascular structure and function. Tctex-1, a light chain of the motor complex dynein, interacts with the cytoplasmic domain of BMPR2 and demonstrate that Tctex-1 is phosphorylated by BMPR-II, a function disrupted by PPH disease causing mutations within exon 12. BMPR2 and Tctex-1 co-localize to endothelium and smooth muscle within the media of pulmonary arterioles, key sites of vascular remodelling in PPH.

References

Machado RD, et al. (2003) Functional interaction between BMPR-II and Tctex-1, a light chain of Dynein, is isoform-specific and disrupted by mutations underlying primary pulmonary hypertension. Hum Mol Genet. 12(24): 3277-86.

Abramowicz MJ, et al. (2003) Primary pulmonary hypertension after amfepramone (diethylpropion) with BMPR2 mutation. Eur Respir J. 22(3): 560-2.

Hassel S, et al. (2004) Proteins associated with type II bone morphogenetic protein receptor (BMPR-II) and identified by two-dimensional gel electrophoresis and mass spectrometry. Proteomics. 4(5): 1346-58.

Beppu H, et al. (2005) Generation of a floxed allele of the mouse BMP type II receptor gene. Genesis. 41(3): 133-7.

Morrell NW. (2006) Pulmonary hypertension due to BMPR2 mutation: a new paradigm for tissue remodeling? Proc Am Thorac Soc. 3(8): 680-6.

Nasim MT, et al. (2008) Stoichiometric imbalance in the receptor complex contributes to dysfunctional BMPR-II mediated signalling in pulmonary arterial hypertension. Hum Mol Genet. 217(11): 1683-94.

Catalog Number:CGA841-CF