Human respiratory syncytial virus (RSV) (subtype A, strain Long) Fusion glycoprotein / RSV-F (Codon Optimized) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

RSV

NCBI Ref Seq

RefSeq ORF Size

1725bp

Gene Synonym

F, HRSVgp08

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of RSV Human RSV (subtype A, strain Long) Fusion glycoprotein / RSV-F Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

References

Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.

Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.

Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.

Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.

Trento A. et al., 2006, J Virol. 80 (2): 975-84.

Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.

Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.

Catalog Number:VGG502-CY