Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

RSV

NCBI Ref Seq

RefSeq ORF Size

1755 bp

Gene Synonym

F, HRSVgp08

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of RSV Human RSV (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

KpnI + XbaI(6kb+1.76kb)

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

References

Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.

Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.

Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.

Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.

Trento A. et al., 2006, J Virol. 80 (2): 975-84.

Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.

Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.

Catalog Number:VGG500-CF