Human cytomegalovirus (HCMV) gB Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

CMV

NCBI Ref Seq

AY315197.2

RefSeq ORF Size

2724bp

Gene Synonym

gB

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of CMV Homo cytomegalovirus gB Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cytomegalovirus (CMV) (human herpesvirus 5) glycoprotein B, also referred as CMV gB or gB, which belongs to the herpesviridae glycoprotein B family. It is a 907-amino acid glycoprotein encoded by the ORF of UL55. Cytomegalovirus Glycoprotein B protein is the most abundant component of the envelope, a target of neutralizing antibodies with at least two defined neutralizing epitopes and an essential replication component. Cytomegalovirus Glycoprotein B protein plays important roles in HCMV entry, cell-cell spread of internal virions, and fusion of infected cells. In addition, Cytomegalovirus Glycoprotein B protein is one envelope protein capable of heparin binding. It forms a physical association with host cell annexin II independent of the presence of calcium.

References

Lopper M,et al. (2002). Disulfide bond configuration of human cytomegalovirus glycoprotein B. J Virol. 76(12): 6073-82.

Isaacson MK, et al. (2009) Human cytomegalovirus glycoprotein B is required for virus entry and cell-to-cell spread but not for virion attachment, assembly, or egress. J Virol. 83(8): 3891-903.

Catalog Number:VGC043-CM