Human Actopaxin Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:VGA176-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1119bp
Gene Synonym
MXRA2, CH-ILKBP
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human parvin, alpha Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Actopaxin, also known as alpha-parvin, belongs to the parvin family. It is widely expressed, with highest levels in heart, skeletal muscle, kidney and liver. Actopaxin contains 2 CH (calponin-homology) domains and probably plays a role in the regulation of cell adhesion and cytoskeleton organization. It interacts with integrin-linked protein kinase and probably with actin and the LD1 and LD4 motifs of PXN. Actopaxin binds directly to both F-actin and paxillin LD1 and LD4 motifs. Actopaxin also exhibits robust focal adhesion localization in several cultured cell types but is not found along the length of the associated actin-rich stress fibers. It is absent from actin-rich cell-cell adherens junctions.
References
  • Korenbaum E, et al. (2002) Genomic organization and expression profile of the parvin family of focal adhesion proteins in mice and humans. Gene. 279(1):69-79.
  • Nikolopoulos SN, et al. (2002) Molecular dissection of actopaxin-integrin-linked kinase-Paxillin interactions and their role in subcellular localization. J Biol Chem. 277(2): 1568-75.
  • Tu Y, et al. (2001) A new focal adhesion protein that interacts with integrin-linked kinase and regulates cell adhesion and spreading. J Cell Biol. 153(3): 585-98.
  • TOP