Rabbit CKMT1A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rabbit

NCBI Ref Seq

NM_001171313.1

RefSeq ORF Size

1254bp

Gene Synonym

CKMT1A

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rabbit creatine kinase, mitochondrial 1A Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CKMT1A belongs to the ATP:guanido phosphotransferase family. It contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. CKMT1A gene is one of two genes which encode the ubiquitous mitochondrial creatine kinase (CKMT1). CKMT1 is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK (CKMT2) and ubiquitous MtCK, encoded by separate genes. CKMT1 occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Ubiquitous mitochondrial creatine kinase has 80% homology with the coding exons of sarcomeric CKMT1.

References

Haas RC, et al. (1989) Isolation and characterization of the gene and cDNA encoding human mitochondrial creatine kinase. J Biol Chem. 264(5):2890-7.

Stachowiak O, et al. (1998) Oligomeric state and membrane binding behaviour of creatine kinase isoenzymes: implications for cellular function and mitochondrial structure. Mol Cell Biochem. 184(1-2):141-51.

Lipskaya TY. (2001) Mitochondrial creatine kinase: properties and function. Biochemistry Mosc. 66(10):1098-111.

Catalog Number:TGB604-CM