Rat Vitronectin/VTN Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:RGI366-CM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1437bp
Gene Synonym
Aa1018,Vn
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat vitronectin Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Vitronectin, also known as VTN, is a member of the pexin family. It is an abundant glycoprotein found in serum the extracellular matrix and promotes cell adhesion and spreading. Vitronectin is a secreted protein and exists in either a single chain form or a cleaved, two chain form held together by a disulfide bond. Vitronectin is a plasma glycoprotein implicated as a regulator of diverse physiological process, including blood coagulation, fibrinolysis, pericellular proteolysis, complement dependent immune responses, and cell attachment and spreading. Because of its ability to bind platelet glycoproteins and mediate platelet adhesion and aggregation at sites of vascular injury, vitronectin has become an important mediator in the pathogenesis of coronary atherosclerosis. As a multifunctional protein with a multiple binding domain, Vitronectin interacts with a variety of plasma and cell proteins. Vitronectin binds multiple ligands, including the soluble vitronectin receptor. It may be an independent predictor of adverse cardiovascular outcomes following acute stenting. Accordingly, Vitronectin is suggested to be involved in hemostasis, cell migration, as well as tumor malignancy.
References
  • Ekmeki OB, et al. (2006) Vitronectin in atherosclerotic disease. Clin Chim Acta. 368(1-2): 77-83.
  • Derer W, et al. (2009) Vitronectin concentrations predict risk in patients undergoing coronary stenting. Circ Cardiovasc Interv. 2(1): 14-9.
  • Heyman L, et al. (2010) Mesothelial vitronectin stimulates migration of ovarian cancer cells. Cell Biol Int. 34(5): 493-502.
  • TOP