Rat VEGFR2/KDR/Flk-1/CD309 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

BC087029.1

RefSeq ORF Size

4032bp

Gene Synonym

Vegfr-2, MGC93590, Kdr

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat kinase insert domain receptor Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

VEGFR2, also called as KDR or Flk-1, is identified as the receptor for VEGF and VEGFC and an early marker for endothelial cell progenitors, whose expression is restricted to endothelial cells in vivo. VEGFR2 was shown to be the primary signal transducer for angiogenesis and the development of pathological conditions such as cancer and diabetic retinopathy. It has been shown that VEGFR2 is expressed mainly in the endothelial cells, and the expression is upregulated in the tumor vasculature. Thus the inhibition of VEGFR2 activity and its downstream signaling are important targets for the treatment of diseases involving angiogenesis. VEGFR2 transduces the major signals for angiogenesis via its strong tyrosine kinase activity. However, unlike other representative tyrosine kinase receptors, VEGFR2 does not use the Ras pathway as a major downstream signaling but rather uses the phospholipase C-protein kinase C pathway to signal mitogen-activated protein (MAP)-kinase activation and DNA synthesis. VEGFR2 is a direct and major signal transducer for pathological angiogenesis, including cancer and diabetic retinopathy, in cooperation with many other signaling partners; thus, VEGFR2 and its downstream signaling appear to be critical targets for the suppression of these diseases. VEGF and VEGFR2-mediated survival signaling is critical to endothelial cell survival, maintenance of the vasculature and alveolar structure and regeneration of lung tissue. Reduced VEGF and VEGFR2 expression in emphysematous lungs has been linked to increased endothelial cell death and vascular regression.

References

Shibuya M. (2006) Vascular endothelial growth factor (VEGF)-Receptor2: its biological functions, major signaling pathway, and specific ligand VEGF-E. Endothelium. 13(2): 63-9.

Marwick JA, et al. (2010) Cigarette smoke regulates VEGFR2-mediated survival signaling in rat lungs. J Inflamm (Lond). 7(1): 11.

Bruns AF, et al. (2010) Ligand-stimulated VEGFR2 signaling is regulated by co-ordinated trafficking and proteolysis. Traffic. 11(1): 161-74.

Catalog Number:RGI353-CM