Rat VEGFC/VEGF-C/Flt4-L Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_053653.1

RefSeq ORF Size

1248bp

Gene Synonym

Vegfc

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat vascular endothelial growth factor C Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Vascular endothelial growth factor C (VEGF-C) is a member of the VEGF family. Upon biosynthesis, VEGF-C protein is secreted as a non-covalent momodimer in an anti-parellel fashion. VEGF-C protein is a dimeric glycoprotein, as a ligand for two receptors, VEGFR-3 (Flt4), and VEGFR-2. VEGF-C may function in angiogenesis of the venous and lymphatic vascular systems during embryogenesis. VEGF-C protein is over-expressed in various human cancers including breast cancer and prostate cancer. VEGF-C/VEGFR-3 axis, through different signaling pathways, plays a critical role in cancer progression by regulating different cellular functions, such as invasion, proliferation, and resistance to chemotherapy. Thus, targeting the VEGF-C/VEGFR-3 axis may be therapeutically significant for certain types of tumors.

References

Joukov V, et al. (1997) Vascular endothelial growth factors VEGF-B and VEGF-C. J Cell Physiol. 173(2): 211-5.

Su JL, et al. (2007) The role of the VEGF-C/VEGFR-3 axis in cancer progression. Br J Cancer. 96(4): 541-5.

Anisimov A, et al. (2009) Activated forms of VEGF-C and VEGF-D provide improved vascular function in skeletal muscle. Circ Res. 104(11): 1302-12.

Catalog Number:RGI350-NM