Rat Urokinase/PLAU Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGI284-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1299bp
Gene Synonym
UPAM
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat plasminogen activator, urokinase Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Plasminogen activator, urokinase, also known as PLAU and uPA, is a serine protease which converts plasminogen to plasmin, a broad-spectrum protease active on extracellular matrix (ECM) components. It is involved in complement activation, cell migration, wound healing, and generation of localized extracellular proteolysis during tissue remodelling, pro-hormone conversion, carcinogenesis and neoplasia. Like many components of the blood coagulation, fibrinolytic and complement cascades, uPA has a modular structure, including three conserved domains: a growth factor-like domain (GFD, residues 1-49), a kringle domain (residues 50-131), linked by an interdomain linker or "connecting peptide" (CP, residues 132-158) to the serine protease domain (residues 159-411). uPA and its receptor (uPAR) have been implicated in a broad spectrum of pathophysiological processes, including fibrinolysis, proteolysis, inflammation, atherogenesis and plaque destabilization, all of which are involved in the pathogenesis of MI (myocardial infarction). The role of uPA is not only linked to its action as an enzyme. In fact, the mere binding of uPA on the cell surface also brings about two events that broaden the spectrum of its biological functions: (1) a conformational change of the receptor, which, in turn, affects its interaction with other proteins; (2) a signal transduction which modulates the expression of apoptosis-related genes. Besides its applications as a thrombolytic agent and as a prognostic marker for tumors, uPA may provide the basis for other therapies, as the structure of the receptor-binding domain of uPA has become a model for the design of anti-cancer molecules. Because of the causal involvment of uPA in cancer invasion and metastasis, the blockade of uPA interactions and activity with specific inhibitors is of interest for novel strategies in cancer therapy.
References
  • Crippa MP. (2007) Urokinase-type plasminogen activator. Int J Biochem Cell Biol. 39(4): 690-4.
  • Kunamneni A, et al. (2008) Urokinase-a very popular cardiovascular agent. Recent Pat Cardiovasc Drug Discov. 3(1): 45-58.
  • Vincenza Carriero M, et al. (2009) Structure, function and antagonists of urokinase-type plasminogen activator. Front Biosci. 14: 3782-94.
  • Xu J, et al. (2010) Association of putative functional variants in the PLAU gene and the PLAUR gene with myocardial infarction. Clin Sci (Lond). 119(8): 353-9.
  • TOP