Rat TrkA/NTRK1 Gene ORF cDNA clone expression plasmid,N terminal His tag

Catalog Number:RGI051-NH

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2400bp
Gene Synonym
Trk, Ntrk1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat neurotrophic tyrosine kinase, receptor, type 1 Gene ORF cDNA clone expression plasmid,N terminal His tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-His
Restriction Site
KpnI(two restriction sites) + XbaI (6kb + 2.19kb + 0.21kb)
Protein Tag
His
Tag Sequence
CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
His Tag Information

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TRKA is a member of the neurotrophic tyrosine kinase receptor (NTKR) family. It is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Isoform TrkA-III promotes angiogenesis and has oncogenic activity when overexpressed. Isoform TrkA-I is found in most non-neuronal tissues. Isoform TrkA-II is primarily expressed in neuronal cells. TrkA-III is specifically expressed by pluripotent neural stem and neural crest progenitors. The presence of NTRK1 leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in TRKA gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, mental retardation and cancer. It was originally identified as an oncogene as it is commonly mutated in cancers, particularly colon and thyroid carcinomas. TRKA is required for high-affinity binding to nerve growth factor (NGF), neurotrophin-3 and neurotrophin-4/5 but not brain-derived neurotrophic factor (BDNF). Known substrates for the Trk receptors are SHC1, PI 3-kinase, and PLC-gamma-1. NTRK1 has a crucial role in the development and function of the nociceptive reception system as well as establishment of thermal regulation via sweating. It also activates ERK1 by either SHC1- or PLC-gamma-1-dependent signaling pathway. Defects in NTRK1 are a cause of congenital insensitivity to pain with anhidrosis and thyroid papillary carcinoma.
References
  • Lambiase A, et al. (2005) Molecular basis for keratoconus: lack of TrkA expression and its transcriptional repression by Sp3. Natl Acad Sci. 102 (46):16795-800.
  • Benito-Gutiérrez E, et al. (2006) Origin and evolution of the Trk family of neurotrophic receptors. Mol Cell Neurosci. 31(2):179-92.
  • Martin-Zanca D, et al. (1986) A human oncogene formed by the fusion of truncated tropomyosin and protein tyrosine kinase sequences. Nature. 319(6056):743-8.
  • TOP