Rat TPST1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:RGH988-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1113bp
Gene Synonym
Tpst1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tyrosylprotein sulfotransferase 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Protein-tyrosine sulfotransferase 1, also known as Tyrosylprotein sulfotransferase 1 and TPST1, is a single-pass type I I membrane protein which belongs to the protein sulfotransferase family. Tyrosine O-sulfation is a common posttranslational modification of proteins in all multicellular organisms. This reaction is mediated by a Golgi enzyme activity called tyrosylprotein sulfotransferase (TPST) that catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to tyrosine residues within acidic motifs of polypeptides. Tyrosine O-sulfation has been shown to be important in protein-protein interactions in several systems. Tyrosine sulfation is mediated by one of two Golgi isoenzymes, called tyrosylprotein sulfotransferases (TPST-1 and TPST-2). A relatively small number of proteins are known to undergo tyrosine sulfation, including certain adhesion molecules, G-protein-coupled receptors, coagulation factors, serpins, extracellular matrix proteins, and hormones. TPST1 is a human tyrosylprotein sulfotransferase that uses 3'phosphoadenosine-5'phosphosulfate (PAPS) to transfer the sulfate moiety to proteins predominantly designated for secretion. TPST1 bears N-linked glycosyl residues exclusively at position Asn60 and Asn262. TPST1 and TPST2 have distinct biological roles that may reflect differences in their macromolecular substrate specificity.
References
  • Ouyang Y.-B.et al., 1998, Proc. Natl. Acad. Sci. USA. 95: 2896-901.
  • Ouyang,Y.B. et al., 2002,J Biol Chem. 277 (26):23781-7.
  • Hoffhines, A.J. et al., 2006, J Biol Chem. 281 (49):37877-87.
  • Goettsch,S. et al., 2006, J Mol Biol. 361 (3):436-49.
  • Westmuckett, A.D. et al., 2008, Gen Comp Endocrinol. 156 (1):145-53.
  • TOP