Rat TNFRSF21/DR6 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_001108207.1

RefSeq ORF Size

1968bp

Gene Synonym

Tnfrsf21

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 21 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

TNFRSF21 (death receptor-6, DR6) is an orphan TNF receptor superfamily member and belongs to a subgroup of receptors called death receptors. This type I transmembrane receptor possesses four extracellular cysteine-rich motifs and a cytoplasmic death domain. DR6 is an extensively posttranslationally modified transmembrane protein and that N- and O-glycosylations of amino acids in its extracellular part. DR6 interacts with the adaptor protein TRADD and mediates signal transduction through its death domain, and expression of DR6 in mammalian cells induces activation of both NF-kappaB and JNK and cell apoptosis. DR6 knockout mice have enhanced CD4+ T cell proliferation and Th2 cytokine production, suggested that DR6 serves as an important regulatory molecule in T-helper cell activation, and is involved in inflammation and immune regulation. DR6 is expressed ubiquitously with high expression in lymphoid organs, heart, brain and pancreas. Some tumor cells overexpress DR6, typically in conjunction with elevated anti-apoptosis molecules. DR6 may also be involved in tumor cell survival and immune evasion, which is subject to future investigations.

References

Pan G, et al. (1998) Identification and functional characterization of DR6, a novel death domain-containing TNF receptor. FEBS Lett. 431(3): 351-6.

Benschop R, et al. (2009) Tumor necrosis factor receptor superfamily member 21: TNFR-related death receptor-6, DR6. Adv Exp Med Biol. 647: 186-94.

Klma M, et al. (2009) Functional analysis of the posttranslational modifications of the death receptor 6. Biochim Biophys Acta. 1793(10): 1579-87.

Catalog Number:RGH927-CY