Rat TNFRSF12A/FN14/TWEAKR Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_181086.2

RefSeq ORF Size

390bp

Gene Synonym

Fn14, MGC72653, Tnfrsf12a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 12a Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Fn14 (tumor necrosis factor receptor superfamily, member 12A), also known as TNFRSF12A, is the receptor for TNFSF12/TWEAK. Fn14 shares 82% amino acid identity with the mouse sequence. It contains a signal peptide, an extracellular domain, a membrane-anchoring domain, and a cytoplasmic domain. In response to FGF1, calf serum, or phorbol ester stimulation of human quiescent fibroblasts in vitro, the level of Fn14 is increased. A 1.2-kb FN14 transcript was expressed at high levels in heart, placenta, and kidney, at intermediate levels in lung, skeletal muscle, and pancreas, and at low levels in brain and liver. In addition, elevated FN14 expression was found in human liver cancer cell lines and hepatocellular carcinoma specimens. Expression of mouse Fn14 was upregulated in hepatocellular carcinoma nodules that develop in 2 different transgenic mouse models of hepatocarcinogenesis. TNFRSF12A is the weak inducer of apoptosis in some cell types. It promotes angiogenesis and the proliferation of endothelial cells. TNFRSF12A may modulate cellular adhesion to matrix proteins.

References

Burkly LC, et al. (2011) The TWEAK/Fn14 pathway in tissue remodeling: for better or for worse. Adv Exp Med Biol. 691:305-22.

Huang M, et al. (2011) Overexpression of Fn14 promotes androgen-independent prostate cancer progression through MMP-9 and correlates with poor treatment outcome. Carcinogenesis. 32(11):1589-96.

Dharmapatni AA, et al. (2011) TWEAK and Fn14 expression in the pathogenesis of joint inflammation and bone erosion in rheumatoid arthritis. Arthritis Res Ther. 13(2):R51.

Catalog Number:RGH925-CF