Rat TGFBR2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:RGH685-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1704bp
Gene Synonym
Tgfbr2T, TGF-beta2, Tgfbr2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat transforming growth factor, beta receptor II Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
TGFBR2 is member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. It is a transmembrane protein. TGFBR2 is comprised by a C-terminal protein kinase domain and an N-terminal ectodomain. The ectodomain consists of a compact fold containing nine beta-strands and a single helix stabilised by a network of six intra strand disulphide bonds. The folding topology includes a central five-stranded antiparallel beta-sheet, eight-residues long at its centre, covered by a second layer consisting of two segments of two-stranded antiparallel beta-sheets. TGFBR2 has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in TGFBR2 gene have been associated with Marfan syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. TGFBR2 attenuates the biological activities of TGF-beta in colorectal cancer. TGFBR2 expression is increased in oral squamous cell carcinoma cells. Its expression is decreased by IL-1beta while inducing Sp3 via NFkappaB. TGFB2 and TGFBR2 are involved in the antiestrogenic activity.
References
  • Yu Y, et al. (2012) MicroRNA-21 induces stemness by downregulating transforming growth factor beta receptor 2 (TGFβR2) in colon cancer cells. Carcinogenesis. 33(1):68-76.
  • Shima K, et al. (2011) TGFBR2 and BAX mononucleotide tract mutations, microsatellite instability, and prognosis in 1072 colorectal cancers. PLoS One. 6(9):e25062.
  • Biros E, et al. (2011) Meta-analysis of the association between single nucleotide polymorphisms in TGF-β receptor genes and abdominal aortic aneurysm. Atherosclerosis. 219(1):218-23.
  • TOP