Rat SULT1A1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_031834.1

RefSeq ORF Size

876bp

Gene Synonym

Stm, Stp1, ASTIV, Mx-ST, PST-1, St1a1, Sult1a3

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Sulfate conjugation catalyzed by cytosolic sulfotransferase (SULT) enzymes. The SULTs are Phase II drug-metabolizing enzymes that catalyze the addition of a sulfuryl moiety to both endogenous compounds, including steroids and neurotransmitters, and certain xenobiotics, including N-hydroxy-2-acetylaminoflourine and phenolic compounds, like alpha-naphthol. SULTs may be involved in the individual genetic disposition, species differences, and organotropisms for toxicological effects of chemicals. Particularly SULT1A1 (Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1), a member of the sulfotransferase 1 subfamily, which is a major pathway for drug metabolism in humans. Humans have at least 10 functional SULT genes. There has been an explosion in information on sulfotransferase polymorphisms and their functional consequences. An Arg213His polymorphism in SULT1A1 has a strong influence on the level of enzyme protein and activity in platelets, which have been widely used for phenotyping. Statistically significant associations were observed between the SULT1A1 genotype (Arg213His) and age, obesity and certain neoplasias (mammary, pulmonary, esophageal and urothelial cancer). Furthermore, the polymorphism of the SULT1A1 may be closely associated with breast cancer.

References

Coughtrie MW. 2002. Sulfation through the looking glass--recent advances in sulfotransferase research for the curious. Pharmacogenomics J. 2(5): 297-308.

Klaassen CD, et al. (1998) Regulation of sulfotransferase mRNA expression in male and female rats of various ages. Chem Biol Interact. 109(1-3): 299-313.

Glatt H. (2000) Sulfotransferases in the bioactivation of xenobiotics. Chem Biol Interact. 129(1-2): 141-70.

Glatt H, et al. (2004) Pharmacogenetics of soluble sulfotransferases (SULTs). Naunyn Schmiedebergs Arch Pharmacol. 369(1): 55-68.

Hebbring SJ, et al. (2008) Sulfotransferase gene copy number variation: pharmacogenetics and function. Cytogenet Genome Res. 123(1-4): 205-10.

Catalog Number:RGH514-NO