Rat STXBP3/UNC-18C Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:RGH501-NM

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1782bp
Gene Synonym
Munc18-c
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat syntaxin binding protein 3 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Syntaxin-binding protein 3, also known as Platelet Sec1 protein, Protein unc-18 homolog 3, Protein unc-18 homolog C, Unc-18C, Unc18-3 and STXBP3, is a cytoplasm protein which belongs to the STXBP/unc-18/SEC1 family. STXBP3 is expressed in cells that exhibit granule exocytosis, such as neutrophils, mast cells, platelets and endothelial cells. STXBP3, together with STX4 and VAMP2, may play a role in insulin-dependent movement of GLUT4 and in docking / fusion of intracellular GLUT4-containing vesicles with the cell surface in adipocytes. STXBP3 participates in the consolidation and secretion of secondary and tertiary granules. STXBP3 contains one SEC1 domain. Phosphorylation at Ser129 may stimulate granule release. Human STXBP3 shares 90% aa identity with mouse STXBP3. STXBP3 interacts with DOC2B; the interaction is direct, occurs at the cell membrane, excludes interaction with STX4 and regulates glucose-stimulated insulin secretion. Interacts with STX4.
References
  • Kidd,M. et al., 2008, Am J Physiol Gastrointest Liver Physiol. 295 (2): G260-72.
  • Macedo,C. et al., 2008, Mol Cell Biochem. 318 (1-2): 63-71.
  • TOP