Rat STAT6 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:RGH455-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2526bp
Gene Synonym
Stat6
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat signal transducer and activator of transcription 6, interleukin-4 induced Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Signal transducer and activator of transcription 6 (STAT6) is a transcription factor that is activated by interleukin-4 (IL-4)-induced tyrosine phosphorylation and mediates most of the IL-4-induced gene expression. STAT6 plays a central role in exerting interleukin-4 (IL-4) mediated biological responses and is found to induce the expression of BCL2L1/BCL-XL, which is responsible for the anti-apoptotic activity of IL4. Transcriptional activation by STAT6 requires the interaction with coactivators like p300 and the CREB-binding protein (CBP). NF-?B and tyrosine-phosphorylated Stat6 can directly bind each other in vitro and in vivo, which suggest that the direct interaction between Stat6 and NF-?B may provide a basis for synergistic activation of transcription by IL-4 and activators of NF-?B. 
References
  • Litterst CM, et al. (2001) Transcriptional activation by STAT6 requires the direct interaction with NCoA-1. J Biol Chem. 276 (49): 45713-21.
  • Stutz AM, et al. (1999) Functional synergism of STAT6 with either NF-kappa B or PU.1 to mediate IL-4-induced activation of IgE germline gene transcription. J Immunol. 163 (8): 4383-91.
  • Yang J, et al. (2002) Identification of p100 as a coactivator for STAT6 that bridges STAT6 with RNA polymerase II. EMBO J. 21 (18): 4950-8.
  • TOP