Rat SPN/CD43 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_001271086.1

RefSeq ORF Size

1173bp

Gene Synonym

PSP, PspnS

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat persephin Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD43 is an abundantly expressed molecule on the T-cell surface that shows distinct localization to the migrating T-cell uropod and the distal pole complex (DPC) opposite the immunological synapse via association with the ezrin-radixin-moesin (ERM) family of actin regulatory proteins. CD43 has a 235-amino acid (aa) extracellular domain, a 23-aa transmembrane domain, and a 123-aa cytoplasmic domain, all encoded by a single exon. The intracytoplasmic region of the protein is necessary to transduce signals; it is rich in potentially phosphorylable threonines and serines but lacks tyrosine residues as well as catalytic activity. CD43 engagement on human peripheral blood T cells and monocytes leads to cell activation and proliferation through the generation of second messengers such as diacylglycerol and inositol phosphates, protein kinase C (PKC) activation and Ca2+ mobilization. In addition, CD43 ligation on human T cells induces the association of CD43 with Src family kinases, presumably through the interaction of their Src homology 3 domain with a proline-rich region of the CD43 intracytoplasmic tail. This molecule has been implicated in T cell activation, enhancing T cell response to allogeneic or mitogenic stimulation and CD43-specific signals have been reported to be sufficient to activate T cells in the absence of T cell receptor (TCR) engagement. In summary, CD43 regulates multiple T-cell functions, including T-cell activation, proliferation, apoptosis, and migration.

References

. Layseca-Espinosa E, et al. (2003) Journal of Leukocyte Biology. 74(6): 1083-93.

Cannon JL, et al. (2011) Mol Biol Cell. 22(7):954-63.

Pallant A,et al. (1989). Proc Natl Acad Sci. 86 (4): 1328–32.

Catalog Number:RGH357-CF